Enzymatic activity of recombinant metallopeptidase for further using in meat industry

Abstract

Enzymatic modification of meat with a high content of connective tissue is an effective mean, allowing to improve its properties and expand its use. Microbial enzymes have been extensively investigated as meat tenderizers. Compliance with safety requirements in terms of forecasting the development of various risks is essential for the use of these enzymes in food industry. The method of producing recombinant protease as a potential candidate for applications on meat tenderization was described in the article.

The aim of this study was the production of recombinant Pichia pastoris with M9 peptidase gene from Aeromonas salmonicida.

Material and methods. Objects: peptidase gene M9 (GenBank: CP000644.1 ASA3723) Aeromonas salmonicida (strain of laboratory collection, isolated from the surface of raw meat), the vector plasmid pPic9K, competent E. coli DH5a cells, competent Pichia pasto -ris GS115 cells, culture fluid (QOL) from recombinant Pichia pastoris clones, beef shank samples. To obtain a recombinant strain, genetic engineering methods, the PCR method, and the bacteriological method were used. Polyacrylamide gel electrophoresis was used to separate and analyze the components of the supernatant. Enzyme activity was evaluated by HPLC-MS/MS using synthesized peptides. The impact of the supernatant from recombinant clones on the connective tissue of raw meat was assessed by histological method.

Results and discussion. A metalloprotease M9 gene was cloned from the Aeromonas salmonicida (2748 bp) and expressed in Pichia pastoris. The molecular mass of the recombinant protein was estimated to be 120 kDa by SDS-PAGE. Histological analyses of the control and enzyme treated beef samples showed degradation intramuscular connective tissue, suggesting its effectiveness on meat tenderization.

Conclusion. The recombinant strain Pichia pastoris, which produces the recombinant M9 peptide of Aeromonas salmonicida, has a specific enzymatic activity against collagen, the main component of the connective tissue of meat. The obtained recombinant peptidase M9 can be used as an enzyme softener of raw meat with a high content of connective tissue.

Keywords:recombinant protease, M9 family, Aeromonas salmonicida, Pichia pastoris, bio modification, meat tenderization

For citation: Makhova A.A., Minaev MYu., Kulikovsky A.V., Vostrikova N.L. Enzymatic activity of recombinant metallopeptidase for further using in meat industry. Voprosy pitaniia [Problems of Nutrition]. 2019; 88 (4): 95-104. doi: 10.24411/0042-8833-2019-10047 (in Russian)

Обработка мясного сырья протеолитическими ферментами растительного, животного и микробного происхождения до сих пор является актуальным направлением мясной отрасли [1, 2]. Так, для получения гидролизованных форм мясного сырья с высоким содержанием коллагена активно используются ферментные препараты щелочных протеаз Bacillus licheniformis и Acremonium chrysogenum. Критериями выбора протеаз в таких случаях часто служат оптимумы действия используемых ферментов, которые должны коррелировать с основными технологическими параметрами мясного производства (рН, температура) [3].

Необходимым условием применения ферментов микробного происхождения в пищевой промышленности является соответствие требованиям безопасности в части прогнозирования развития различных рисков. Европейское агентство по безопасности пищевых продуктов (EFSA) постоянно обновляет перечень микро-организмов-продуцентов ферментов, имеющих статус "Квалифицирован предположительно как безопасный -Qualified Presumption of Safety (QPS)". При этом статус QPS обозначает факт того, что данный штамм прошел необходимую оценку его безопасности. К условно безопасным микроорганизмам относят многие молочнокислые бактерии (Lactococcus и Lactobacillus), бифидобактерии, дрожжи [4].

Многие протеазы могут интенсивно катализировать гидролиз целого ряда белков (в том числе белков мышечной ткани) - обладать общим протеолитическим действием, но при этом слабо воздействовать на белки соединительной ткани. Поэтому не каждая протеаза, расщепляющая коллаген, может называться коллаге-назой. Согласно современной классификации, представленной в базе данных MEROPS, ферменты подразделяются на кланы и семейства. Особый интерес для исследования коллагеназной активности представляет семейство металлопротеаз М9, типичными продуцентами которого являются патогенные микроорганизмы Clostridium histolyticum и Vibrio alginolyticus [5]. Именно они способны воздействовать на связь "Gly-Pro" (глицин-пролин) - специфическую аминокислотную последовательность коллагена [6].

Аминокислотная последовательность пептидазы М9 несет специфический HEXXH-мотив - цинк-связывающую последовательность, в которой 2 гистидиновых цинковых лиганда хелатируют каталитический центр [7].

Аналогичный мотив HEYTH содержит пептидаза M9 Aeromonas salmonicida, по доменной организации схожая с пептидазой Vibrio класса II. Пептидазы Vibrio класса II имеют цинк-связывающий HEYTH-мотив, не содержат C-концевой последовательности и не обладают способностью гидролизовать казеин. VMC-коллагеназа Vibrio mimicus - представитель вибриозной пептидазы II класса подсемейства М9А, способная гидролизовать коллагены I, II, III типов, желатин, синтетические субстраты Cbz-GPLGP [8, 9].

Проблемой использования в качестве продуцентов специфичных пептидаз исходных штаммов-продуцентов является выработка ими целого пула ферментов, близких по молекулярной массе к искомому, что делает очистку и получение нужного фермента невозможным. За рубежом запатентована технология получения высокоочищенной коллагеназы Clostridium hystolyticum, которая составляет основу медицинского препарата для лечения контрактуры Дюпюитрена [10]. Фермент отличается высокой степенью очистки, однако стоимость его получения делает невозможным применение данной технологии в пищевой промышленности.

Основным инструментом пищевой биотехнологии для производства рекомбинантных ферментов становятся клетки дрожжей [11, 12]. Дрожжи, являясь простыми эукариотами, обладают преимуществами в плане фолдинга и посттрансляционных модификаций белка [13]. Более того, дрожжи превосходно изучены биохимическими методами и методами молекулярной биологии, для них подобраны методы генетической инженерии [14]. Для Pichia pastoris хорошо отработаны методы интеграции в геном, трансформации с помощью электропорации и др. [15].

Цель исследования - получить рекомбинантную пептидазу М9 Aeromonas salmonicida и изучить ее ферментативную активность.

Материал и методы

Объектами исследований являлись ген пептидазы M9 (GenBank: CP000644.1 ASA_3723) Aeromonas salmonicida (штамм лабораторной коллекции, выделен с поверхности мясного сырья), векторная плазмида pPic9K (Invitrogen, США), компетентные клетки Escherichiarnli (E. rnli) DH5a (Invitrogen, США), компетентные клетки Pichia pastoris GS115 (Invitrogen, США), культуральная жидкость (КЖ) от рекомбинантных клонов Pichia pastoris, образцы говяжьей голяшки.

Анализ нуклеотидной последовательности, кодирующей ген пептидазы Aeromonas salmonicida, проводили с помощью базы данных NCBI [16].

Для анализа и сравнения нуклеотидных последовательностей использовали программу "BLAST", поиск гомологичных последовательностей осуществляли в базе данных GenBank [16].

Биоинформационный анализ последовательностей кодирующих генов пептидаз Aeromonas salmonicida, дизайн праймеров проводили с помощью программы Oligo-Analyzer Tool [17].

Для выделения плазмидной ДНК использовали набор для выделения плазмид QIAprep Spin Miniprep Kit (Qiagen, ФРГ). ДНК выделяли согласно протоколу производителя.

Амплификацию ДНК методом полимеразной цепной реакции (ПЦР) проводили на приборе АНК-32 ("Син-тол", Росси) в реакционной смеси, содержащей HS-Fuzz буфер, дезоксинуклеозидтрифосфат (dNTP), 5- и 3’-кон-цевые праймеры, ДНК и HS-Fuzz ДНК-полимеразу1 (NEB, Великобритания).

1 ДНК-полимераза, выделенная из рекомбинантного штамма E. coli, несущего ген химерной полимеразы Pyrococcus furiosis, катализирует полимеризацию нуклеотидов в направлении от 5’-3’.

Праймеры, используемые для получения гена протеазы Aeromonas salmonicida:

AACAATCTGGGTACAAGGT - форвард-праймер;

TCAGTGGGAGGAGTCGTTG - реверс-праймер.

Скрининг рекомбинантных клонов проводили с помощью ПЦР с использованием стандартных праймеров для вектора pPic9K.

Препаративное выделение фрагмента ДНК. Для выделения и очистки целевых ПЦР-продуктов использовали набор для выделения ДНК из агарозного геля и реакционных смесей Cleanup Standard ("Евроген", Россия). Выделение выполняли согласно протоколу производителя.

Безлигазное клонирование. Встраивание полученных ПЦР-фрагментов в векторную плазмиду pPic9K проводили с использованием безлигазной системы для клонирования In-FusionTM CF Dry-Down PCR Cloning Kit фирмы (Clontech Laboratories, Inc., США). ДНК фрагментов и векторную ДНК (в молярном соотношении 2:1) инкубировали в присутствии смеси белков для рекомбинации при 42 °С в течение 30 мин.

Трансформация Escherichia coli. Препарат ДНК добавляли к 100 мм3 химически компетентных клеток E. Coli и инкубировали на льду в течение 40 мин. После теплового шока (42 °С, 40 с) пробирки охлаждали на льду, затем добавляли 0,9 см3 среды SOC2, содержащей 1% глюкозы, инкубировали (1 ч при 37 °C) и высевали на чашки Петри с агаризованной средой LB3, содержащей антибиотики, необходимые для селекции. Инкубировали чашки Петри до появления единичных клонов размером 1- 2 мм при 37 °С.

Анализ рекомбинантных, клонов E. coli. Скрининг рекомбинантных плазмид проводили методом ПЦР с использованием М13 праймеров. Ресуспендировали часть материала каждого клона в 10 мм3 ПЦР-смеси. После проведения ПЦР смесь наносили в лунки 0,8-1% агарозного геля в стандартном буфере для нанесения (глицерин 5%, бромфенол голубой 0,05%, ксиленцианол 0,05%). Электрофорез проводили в буфере ТАЕ : 40 мМ Трис-ацетат, 2 мМ ЭДТА, pH 8,0. Агарозный гель в дальнейшем окрашивали этидиумбромидом и анализировали в ультрафиолетовом облучении. По результатам электрофореза отбирали клоны, содержащие плазмиды со вставками подходящего размера (по маркеру длины -3000 пар нуклеотидов). Из отобранных клонов выделяли плазмидную ДНК.

Электропорация Pichia pastoris. Мягко размораживали компетентные клетки в ледяной бане. Добавляли 2- 5 мм3 линеаризованной ДНК плазмид (1-5 мкг), инкубировали 5 мин во льду. Аккуратно перемешивали и переносили в охлажденную кювету (2 мм) для электропорации. Проводили электропорацию на электро-пораторе при следующих параметрах: напряжение = 1500 В, емкость = 25 Ф, сопротивление = 200 Ом. Добавляли сразу же 0,5 см3 охлажденного 1 М сорбитола и держали на льду. Перемешивали и переносили суспензию на чашку с селективной средой, растирали шпателем. Инкубировали 2-3 сут при 30 °С до появления колоний.

Анализ рекомбинантных, клонов Pichia pastoris на продукцию целевых белков. Для анализа экспрессии клонированных генов проводили культивирование штаммов в малых объемах. Отдельные колонии рекомбинантных штаммов Pichia pastoris, отобранные на селективной среде, инокулировали в пробирки с 3 см3 жидкой среды BMSY4 и выращивали при 29 °С с сильной аэрацией в течение 48 ч. Затем в течение 5 дней проводили индукцию, ежедневно добавляя метанол до конечной концентрации 0,5%. Каждый раз перед добавлением метанола отбирали пробы для электрофоретического анализа.

Электрофорез в полиакриламидном геле (ПААГ). Для электрофореза белков использовали 12% ПААГ Разделяющий гель содержал 1х буфер разделяющего геля, акриламид, бисакриламид, персульфат аммония и тетраметилэтилендиамин (TEMED). Концентрирующий гель (3%) содержал 1х буфер концентрирующего геля, акриламид, бисакриламид, персульфат аммония и TEMED - инициатор полимеризации акриламида. Концентрирующий гель наслаивали на заполимеризованный разделяющий гель. Гель окрашивали с применением 0,1% Кумасси бриллиантового синего G-250, растворенного в 7,5% уксусной кислоте. Электрофорез проводили в трис-глициновом буфере (SDS-электрофорезный буфер).

Клетки осаждали, удаляли супернатант в случае анализа внутриклеточных белков, ресуспендировали в воде и добавляли буфер для электрофореза белков (Samples Buffer). Для белков жидкой фракции к аликвоте добавляли Samples Buffer. После прогревания на кипящей водяной бане в течение 5 мин наносили образец на SDS-PAAG. Использовали стандартные маркеры молекулярных масс.

Культивирование микроорганизмов. Е. coli выращивали в жидких и на агаризованных средах LB при 37 °С. Агаризованная среда на основе LB содержала 15 г/дм3 бактоагара. Для селекции клонов, содержащих плазмиду pPic9K, использовали среду LB с ампициллином (100 мкг/см3).

Pichia pastoris культивировали при 29 °С на среде YPD5. Для селекции рекомбинантных клонов после трансформации использовали агаризованную среду MD6: 1,34% YNB7 без аминокислот (Sigma, США), 4х10-5% биотин, 2% глюкоза, 2% агар. Для продукции целевых белков рекомбинантные штаммы Pichia pastoris выращивали с интенсивной аэрацией в жидкой среде BMSY: 1% дрожжевой экстракт, 2% пептона (BD), 100 мМ калий фосфатный буфер, 1,34% YNB с аминокислотами (Sigma, США), 4х10-5% биотин, 1% сорбитол.

2 Super Optimal broth with Catabolite repression (SOC) - жидкая питательная среда (питательный бульон), используемая для выращивания трансформированных клеток E. coli.

3 Lysogeny broth, Luria-Bertani medium (agar) - питательная среда для роста культур бактерий.

4 Buffered minimal sorbitol-complex medium - питательная среда для ферментации Pichia pastoris.

5 Yeast extract peptone dextrose medium - питательная среда для выращивания Pichia pastoris.

6 Агар для селекции рекомбинантных клонов Pichia pastoris после трансформации.

7 Yeast nitrogen base - азотно-дрожжевой агар для селекции рекомбинантных клонов после трансформации.

Оценка ферментативной активности методом ВЭЖХ-МС/МС с использованием искусственно синтезированных пептидов. Для анализа подобраны следующие параметры масс-спектрометрического детектирования:

- температура источника - 100 °С;

- температура газа десольвации - 320 °С;

- скорость потока газа десольвации - 8 дм3/мин;

- давление иглы распылителя - 30 psi.

Условия регистрации аналитических сигналов в режиме мониторинга множественных реакций (MRM) представлены в таблице. Условия детектирования оптимизировали в ручном режиме. Для этого используются растворы пептидов различных концентраций - 500, 100 и 10 нг/см3. При этом соотношение сигнал/шум (S/N) молекулярного иона должно быть не менее 1:10. Напряжение на фрагменторе оптимизировали с шагом 10 V по максимальному отклику протонированного молекулярного иона. Энергию диссоциации оптимизировали с шагом 5 V по максимальному отклику характерного дочернего иона.

Оценку ферментативной активности КЖ от клонов Pichia pastoris проводили гистологическим методом. Опытные образцы обрабатывали культуральной жидкостью путем шприцевания (опыт № 1) и погружения (опыт № 2), экспозиция - 24 ч при 8 °С. Контрольный образец мяса обрабатывали физиологическим раствором. Далее все образцы фиксировали в 10% забуференном растворе формалина в течение 72 ч. Срезы толщиной 16 мкм изготавливали на криостате "MICROM - HM525" (Thermo Scientific, США), монтировали на стекла Menzel-Glaser (Thermo Scientific, США) и окрашивали гематоксилином Эрлиха и 1% водно-спиртовым раствором эозина ("БиоВитрум", Россия), далее заключали в глицерин-желатин. Изучение гистологических препаратов осуществляли на световом микроскопе "AxioImaiger A1" (Carl Zeiss, Германия) с применением компьютерной системы анализа изображений "AxioVision 4.7.1.0".

Сущность методики заключалась в возможности определения активности пептидазы в мультиплексной реакции с пептидами различной последовательности, что позволило определить специфичность изучаемой пептидазы в одной ферментативной реакции. По площади дочерних ионов искомого пептида определяли степень его деградации. По протонированным ионам определяли молярную массу продуктов распада пептида и идентифицировали их аминокислотную последовательность.

Биоинформационный анализ, оптимизация гена пептидазы M9 Aeromonas salmonicida (ASA_3723)

Генно-инженерные манипуляции часто связаны с использованием векторных систем E. coli; в данной работе был использован челночный вектор, способный реплицироваться как в бактериальных, так и в дрожжевых клетках. В качестве вектора для экспрессии в Pichia pastoris была использована плазмида pPic9K. Эта плазмида содержит репликон pBR322, позволяющий ей автономно реплицироваться в клетках E. coli. Благодаря этому первичный отбор рекомбинантных клонов производится в E. coli. В Pichia pastoris эта плазмида поддерживается за счет интеграции в хромосому. Экспрессия клонированных в этой плазмиде генов находится под контролем АОХ1-промотора, эффективно индуцируемого метанолом. Для обеспечения эффективной секреции продукта вектор содержит нуклеотидную последовательность, кодирующую сигнальный пептид альфа-фактора. Полилинкер векторной молекулы содержит удобные сайты для клонирования (рис. 1).

Аминокислотная последовательность пептидазы М9 Aeromonas salmonicida представлена последовательностями сигнального пептида и домена пептидазы.

Последовательность сигнального пептида располагается на N-конце молекулы и разделена с доменом пептидазы 614 аминокислотами (рис. 2). Большинство охарактеризованных к настоящему времени протеиназ из различных источников первоначально синтезируется в виде лишенных активности предшественников - проферментов, в молекулах которых после секреторного лидера (сигнальный пептид) содержатся активационный и каталитический домены. Известно, что активация предшественников, приводящая к появлению протеолитической активности, сопровождается отщеплением и деградацией соответствующего активационного домена. Однако, как видно из описания к рис. 2, у изучаемой пептидазы отсутствует активационный домен, то есть фермент продуцируется сразу в свободной форме. Для подтверждения данного свойства изучаемого фермента была создана его ЗЭ-модель (рис. 3).

В настоящее время определены укладки множества белков, поэтому почти для каждой новой белковой структуры уже есть аналог в банке PDB. Анализ укладки молекулярной модели фермента позволяет создавать новые и оптимизировать существующие белок-кодирующие последовательности.

Как видно из рис. 3, у фермента Aeromonas salmoni-cida действительно отсутствует N-концевой активационный домен, блокирующий активность каталитического центра.

При встраивании гена пептидазы М9 в чужеродную клетку отсутствие предшественника целевого белка может привести к сверхсинтезу токсичного продукта чужеродного гена и оказать губительное влияние на рост и деление микробной клетки. Это свойство наряду с токсичностью экспрессируемого белка может привести к плазмидной нестабильности или гибели микробной клетки-хозяина. Для минимизации этого эффекта был использован вектор, в который включены элементы, снижающие экспрессию базальной Т7 РНК-полимеразы.

Было проведено встраивание нативного гена пептидазы М9 Aeromonas salmonicida в вектор pPic9K. На электрофорезе была отмечена неяркая полоса на 120 кДа (предположительно целевой белок), что свидетельствует о наработке малого количества белка. Последнее может быть связано с длиной нативного гена пептидазы M9 Aeromonas salmonicida, которая составляет 2748 базовых пар нуклеотидов. Это довольно крупный для генетических манипуляций фрагмент: его сложно безошибочно амплифицировать из ДНК хозяина, получить в больших количествах, очистить и удачно вставить в вектор.

На данном этапе работы было принято решение вычленить из нативного гена расположенную на С-конце молекулы аминокислотную последовательность домена собственно пептидазы М9 длиной 864 b.p, без сигнального пептида и предшествующей последовательности.

Праймеры, используемые для получения последовательности, кодирующей собственно домен протеазы:

GGCTGAAGCTTACGTAATGGGTCTCTGCACCCCGATAC -форвард-праймер;

TCAGTGGGAGGAGTCGTTG - реверс-праймер.

Были проведены клонирование активного домена гена пептидазы М9 Aeromonas salmonicida и трансформация клеток Pichia pastoris, наработана культуральная жидкость от рекомбинантных клонов.

Оценка ферментативной активности

На рис. 4 представлен масс-спектр чистого пептида Pro-Leu-Gly-Met-Trp-Ser-Arg в режиме селективного ионного мониторинга (SIM) с ионизацией распылением в электрическом поле (ESI) с регистрацией положительных ионов. Для построения градуировочной характеристики и расчета количественного содержания пептида в качестве молекулярного иона был выбран m/z 423,6; в качестве протонированного дочернего иона - m/z 846,2.

При воздействии на пептид фермента были получены продукты распада, один из них дал характерный пик с m/z 206,0. Расчетным путем было установлено, что этим продуктом являлся дипептид лейцин-глицин (Leu-Gly). Хроматограмма пробы после ферментного гидролиза представлена на рис. 5. Для количественного определения дипептида Leu-Gly были подобраны условия ионизации в режиме SIM.

Скорость гидролиза пептида Pro-Leu-Gly-Met-Trp-Ser-Arg была изучена по уменьшению площади основного пика с m/z 423,7. Для этого субстрат обрабатывали ферментом в различных соотношениях, масс-спектральный анализ проводили через 1, 2, 3 ч. Реакцию ингибировали растворами EDTA и EGTA. Хроматограммы этих образцов представлены на рис. 6.

Через 2 ч воздействия рекомбинантной пептидазой М9 площадь специфического пика сократилась более чем 2 раза, через 3 ч - на порядок. В перерасчете на концентрацию пептида снижение составило 27,2 и 46,5% соответственно.

Результаты оценки деградации соединительной ткани говяжьей голяшки после обработки исследуемых образцов культуральной жидкости от рекомбинантных клонов Pichia pastoris со вставкой нативного гена пептидазы M9 Aeromonas salmonicida

Результаты гистологического исследования образцов мясного сырья, обработанных культуральной жидкостью от рекомбинантных клонов Pichia pastoris со вставкой активного домена гена пептидазы М9 Aeromonas salmonicida, представлены на рис. 7 и 8.

В контрольном образце (обработан физиологическим раствором) мышечные волокна характеризовались спрямленной формой, хорошо выраженной поперечной исчерченностью и достаточно плотной компоновкой в пучке. Ядра овальной формы располагались непосредственно под сарколеммой волокна. Волнистые соединительнотканные прослойки перимизия плотно прилегали к пучкам мышечных волокон. Ядра в соединительнотканных прослойках отчетливо выявлялись на препарате (см. рис. 7).

В опытном образце отмечены изменения в структуре соединительной ткани: разрыхление прослоек перимизия, их отслоение от мышечных пучков, дезинтеграция и фрагментация фибрилл (см. рис. 8). Существенных изменений в структуре мышечных волокон не выявлено.

Таким образом, в результате проведенных гистологических исследований установлено влияние полученной в обоих случаях КЖ на структуру соединительной ткани мясного сырья, что в дальнейшем может быть использовано в мясной промышленности.

Проведено успешное клонирование последовательности нативного гена пептидазы М9 Aeromonas salmonicida. В статье Q. Sun, F. Chen описан способ получения рекомбинантной аспартатной протеазы из Rhizomucor miehei, экспрессируемой в Pichia pastoris, способной найти применение в умягчении мясного сырья [18]. Полученный фермент обладал высокой общей протеолитической активностью (3480,4 Ед/мл). Было отмечено эффективное использование рекомбинантной аспартатной протеазы в умягчении свинины, соединительной ткани в которой сравнительно мало. Можно предположить, что тендеризация мяса в этом случае достигается деградацией мышечных белков, а не белков соединительной ткани.

В нашем случае рекомбинантный штамм Pichia pastoris, продуцент рекомбинантной пептидазы М9 Aeromonas salmonicida, обладает специфичной ферментативной активностью в отношении коллагена - основного компонента соединительной ткани мяса, и не содержит в своем составе маркеров антибиотикоустойчивости. В результате проведенных гистологических исследований образцов мясного сырья установлено влияние полученной КЖ на структуру соединительной ткани при отсутствии воздействия на мышечную ткань.

Планируется дальнейшая работа по биоинформационной оптимизации гена-вставки, подбору оптимальных условий культивирования и индукции рекомбинантных клонов с целью увеличения выхода рекомбинантного белка.

Конфликт интересов. Авторы статьи подтверждают отсутствие конфликта интересов.

Литература

1. Chanalia P., Gandhi D., Attri P., Dhanda S. Extraction, purification and characterization of low molecular weight Proline imino-peptidase from probiotic L. plantarum for meat tenderization // Int. 5. J. Biol. Macromol. 2018. Vol. 109. P. 651-663.

2. Zhao G.Y., Zhou M.Y., Zhao H.L., Chen X.L., Xie B.B., Zhang X.Y. et al. Tenderization effect of cold-adapted collagenolytic protease MCP-01 on beef meat at low temperature and its mechanism //

3. Титов Е.И., Литвинова Е.В., Кидяев С.Н., Пчелкина В.А. О микроструктуре коллагенсодержащего сырья, модифицированного щелочными протеиназами // Мясная индустрия. 2017. № 8. С. 36-38.

4. Багрянцева О.В., Шатров Г.Н. О необходимости внесения изменений в законодательство Евразийского Экономического 8. Союза в области нормирования ферментных препаратов // Сборник научных трудов ГНУ ВНИИПБ "Перспективные ферментные препараты и биотехнологические процессы в технологиях продуктов питания и кормов". М., 2014. С. 101-108.

5. Eckhard U., Huesgen P.F., Brandstetter H., Overall C.M. Pro-teomic protease specificity profiling of clostridial collagenases reveals their intrinsic nature as dedicated degraders of collagen // J. Proteomics. 2014. Vol. 100. P. 102-114.

6. Eckhard U., Schonauer E., Brandstetter H. Structural basis for activity regulation and substrate preference of clostridial collagenases G, H, and T // J. Biol. Chem. 2013. Vol. 288. P. 20 184-20 194.

7. Nezafat, Navid & Negahdaripour, Monica & Gholami, Ahmad & Younes, Ghasemi. Computational analysis of collagenase from different Vibrio, Clostridium and Bacillus strains to find new enzyme sources // Trends Pharm. Sci. 2015. Vol. 1, N 4. P. 213-222.

8. Zhang Y.Z., Ran L.Y., Li C.Y., Chen X.L. Diversity, structures, and collagen-degrading mechanisms of bacterial collagenolytic proteases // Appl. Environ. Microbiol. 2015. Vol. 81, N 18. P. 6098-6107.

9. Miyoshi S., Nitanda Y., Fujii K., Kawahara K., Li T., Maehara Y. et al. Differential gene expression and extracellular secretion of the collagenolytic enzymes by the pathogen Vibrio parahaemolyticus // FEMS Microbiol. Lett. 2008. Vol. 283, N 2. P. 176-181.

10. Brazzelli M., Cruickshank M., Tassie E., McNamee P., Robertson C., Elders A. et al. Collagenase clostridium histolyticum for the treatment of Dupuytren’s contracture: systematic review and economic evaluation // Health Technol. Assess. 2015. Vol. 19, N 90. P. 201-202.

11. Арыкбаева А.Б. Дрожжи Saccharomyces cerevisiae в генетической инженерии // Сборник "Альманах научных работ молодых ученых Университета ИТМО". СПб., 2016. С. 8891.

12. Rabert C., Weinacker D., Pessoa A., Farias Jr. Recombinants proteins for industrial uses: utilization of Pichia pastoris expression system // Braz. J. Microbiol. 2013. Vol. 44, N 2. P. 351356.

13. Queiroz Brito Cunha C.C., Gama A.R., Cintra L.C., Bataus L.A.M., Ulhoa C.J. Improvement of bread making quality by supplementation with a recombinant xylanase produced by Pichia pastoris // PLoS One. 2018. Vol. 13, N 2. P. 1-14.

14. Macauley-Patrick S., Fazenda M.L., McNeil B., Harvey L.M. Heterologous protein production using the Pichia pastoris expression system // Yeast. 2005. Vol. 22. P. 249-270.

15. Silva V.C., Peres, M.F.S., Gattas E.A.L. Application of methylotro-phic yeast Pichia pastoris in the field of food industry - a review // J. Food Agric. Environ. 2009. Vol. 2. P. 268-273.

16. URL: https://www.ncbi.nlm.nih.gov

17. URL: https://eu.idtdna.com/calc/analyzer

18. Sun Q., Chen F., Geng F., Luo Y., Gong S., Jiang Z. A novel aspartic protease from Rhizomucor miehei expressed in Pichia pastoris and its application on meat tenderization and preparation of turtle peptides // Food Chem. 2017. Vol. 245. P. 570-577. URL: https:// doi.org/10.1016/j.foodchem.2017.10.113

References

1. Chanalia P., Gandhi D., Attri P., Dhanda S. Extraction, purification and characterization of low molecular weight Proline imino-peptidase from probiotic L. plantarum for meat tenderization. Int J Biol Macromol. 2018; 109: 651-63.

2. Zhao G.Y., Zhou M.Y., Zhao H.L., Chen X.L., Xie B.B., Zhang X.Y., et al. Tenderization effect of cold-adapted collagenolytic protease MCP-01 on beef meat at low temperature and its mechanism. Food Chem. 2012; 134 (4): 1738-44.

3. Titov E.I., Litvinova E.V., Kidjaev S.N., Pchelkina V.A. About the microstructure of collagen-containing raw materials modified with alkaline proteinases. Myasnaya industriya [Meat Industry]. 2017; (8): 36-8. (in Russian)

4. Bagryantseva O.V., Shatrov G.N. On the need for changes in the legislation of the Eurasian Economic Union in the field of rationing enzyme preparations. In: Sbornik nauchnyh trudov GNU VNI-IPB "Perspektivnye fermentnye preparaty i biotehnologicheskie processy v tehnologijah produktov pitanija i kormov" [Proceedings of the GNU VNIIPB "Advanced enzyme preparations and biotechnological processes in food and feed technologies"]. Moscow, 2014: 101-8. (in Russian)

5. Eckhard U., Huesgen P.F., Brandstetter H., Overall C.M. Pro-teomic protease specificity profiling of clostridial collagenases reveals their intrinsic nature as dedicated degraders of collagen. J Proteomics. 2014; 100: 102-14.

6. Eckhard U., Schonauer E., Brandstetter H. Structural basis for activity regulation and substrate preference of clostridial collage-nases G, H, and T. J Biol Chem. 2013; 288: 20 184-94.

7. Nezafat, Navid & Negahdaripour, Monica & Gholami, Ahmad & Younes, Ghasemi. Computational analysis of collagenase from different Vibrio, Clostridium and Bacillus strains to find new enzyme sources. Trends Pharm Sci. 2015; 1 (4): 213-22.

8. Zhang Y.Z., Ran L.Y., Li C.Y., Chen X.L. Diversity, structures, and collagen-degrading mechanisms of bacterial collagenolytic proteases. Appl Environ Microbiol. 2015; 81 (18): 6098-107.

9. Miyoshi S., Nitanda Y., Fujii K., Kawahara K., Li T., Maehara Y., et al. Differential gene expression and extracellular secretion of the collagenolytic enzymes by the pathogen Vibrio parahaemolyticus. FEMS Microbiol Lett. 2008; 283 (2): 176-81.

10. Brazzelli M., Cruickshank M., Tassie E., McNamee P., Robertson C., Elders A., et al. Collagenase clostridium histolyticum for the treatment of Dupuytren’s contracture: systematic review and economic evaluation. Health Technol Assess. 2015; 19 (90): 201-2.

11. Arykbaeva A.B. Yeast Saccharomyces cerevisiae in genetic engineering. In: Sbornik "Al’manah nauchnyh rabot molodyh uchenyh Universiteta ITMO" [Collection "Almanac of scientific works of young scientists of ITMO University"]. Saint Petersburg, 2016: 88-91. (in Russian)

12. Rabert C., Weinacker D., Pessoa A., Farias Jr. Recombinants proteins for industrial uses: utilization of Pichia pastoris expression system. Braz J Microbiol. 2013; 44 (2): 351-6.

13. Queiroz Brito Cunha C.C., Gama A.R., Cintra L.C., Bataus L.A.M., Ulhoa C.J. Improvement of bread making quality by supplementation with a recombinant xylanase produced by Pichia pastoris. PLoS One. 2018; 13 (2): 1-14.

14. Macauley-Patrick S., Fazenda M.L., McNeil B., Harvey L.M. Heterologous protein production using the Pichia pastoris expression system. Yeast. 2005; 22: 249-70.

15. Silva V.C., Peres, M.F.S., Gattas E.A.L. Application of methylo-trophic yeast Pichia pastoris in the field of food industry - a review. J Food Agric Environ. 2009; 2: 268-73.

16. URL: https://www.ncbi.nlm.nih.gov

17. URL: https://eu.idtdna.com/calc/analyzer

18. Sun Q., Chen F., Geng F., Luo Y., Gong S., Jiang Z. A novel aspartic protease from Rhizomucor miehei expressed in Pichia pastoris and its application on meat tenderization and preparation of turtle peptides. Food Chem. 2017; 245: 570-7. URL: https:// doi.org/10.1016/j.foodchem.2017.10.113